The growing demand for energy-efficient and high-speed information processing has driven intense research into magnonics—a field centered on the manipulation of spin waves (magnons) as extremely energy-efficient information carriers1. In CMOS…
Category: 4. Physics
-
Tau accelerates tubulin exchange in the microtubule lattice
Molecular cloning, expression and purification of tau
The gene coding for Tau2N4R was amplified by polymerase chain reaction using the primers flanked with the restriction sites NotI and AscI at the 5′ (AATAATAACATGCGGCCGCAA TGGCTGAGCCCCGCC) and…
Continue Reading
-
Space-time crystals from particle-like topological solitons
Chaikin, P. M. & Lubensky, T. C. Principles of Condensed Matter Physics (Cambridge Univ. Press, 2000).
Yeh, P. & Gu, C. Optics of Liquid Crystal Displays (Wiley, 2010).
Wilczek, F. Quantum time crystals. Phys. Rev. Lett. 109, 160401 (2012).
Continue Reading
-
The origin of the axial Higgs is a hidden ferroaxial electronic density wave
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This is a summary of: Singh, B. et al. Ferroaxial density wave from intertwined charge and orbital order in…
Continue Reading
-
Photons learn to classify with a quantum edge
Photons learn to classify with a quantum edge
Continue Reading
-
Patently funny and possibly useful
To celebrate this year’s Ig Nobel Prize, we review some patents that raise a chuckle but are closer to serious research than it may seem at first glance.
How many inventors does it take to change a…
Continue Reading
-
DESI Hints Dark Energy Isn’t What We Thought
The Dark Energy Spectroscopic Instrument is mounted on the U.S. National Science Foundation’s Nicholas U. Mayall 4-meter Telescope at Kitt Peak National Observatory—a program of NSF NOIRLab—in Arizona. Credit:… Continue Reading
-
Ultracold Atoms Simulate Breaking Flux Strings
• Physics 18, s106
An optical-lattice experiment offers a platform for observing dynamics of particle–antiparticle pair creation in quantum field theories.
Y. Liu et al. [1]; adapted by APSContinue Reading
-
Physics – Understanding Young Earth’s Dynamo
• Physics 18, 153
A simulation of unprecedented resolution explains how Earth could possess a magnetic-field-generating dynamo before the planet’s inner core began to solidify.
Y. Lin/SUSTech
Earth’s dynamo could… Continue Reading
-
A simple metal could solve the world’s plastic recycling problem
The future of plastic recycling may soon get much less complicated, frustrating and tedious.
In a new study, Northwestern University chemists have introduced a new plastic upcycling process that can drastically reduce — or perhaps even fully…
Continue Reading